Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol CDX2
Name caudal type homeobox 2
Class/Family ANTP/Cdx
Type protein-coding
Organism Human
Location 13q12.2
Synonyms CDX3;
Link out HGNC(1806)  Gene(1045)  RefSeq(NM_001265)  OMIM(600297)  
Comments  
 
Homeodomain
HD1: KDKYRVVYTD HQRLELEKEF HYSRYITIRR KAELAATLGL SERQVKIWFQ NRRAKERKIN
 
Noncoding Regulator(s)
hsa-mir-9 Function Sequence: UCUUUGGUUAUCUAGCUGUAUGA
Location: chromosome 1q22; 5q14.3
Target Position in 3'UTR of transcript ENST00000381020: 513/974,
indicating as '#':

+-------------------------------------------#--------------------------------------+
target 5'      A       C          C 3'
                AGCUGGA UGACCAAAGA    
                UCGAUCU AUUGGUUUCU    
miRNA  3' AGUAUG                    5'

mfe: -28.1 kcal/mol  p-value: 0.589891
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Rotkrua P. et al. 2011. Int J Cancer [PubMed:21225631]
HGNC:31641
HGNC:31642
miRBase:MI0000466
miRBase:MI0000467
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1