Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol HOXA7
Name homeobox A7
Class/Family ANTP/Hox6-8
Type protein-coding
Organism Human
Location 7p15.2
Synonyms HOX1A
Link out HGNC(5108)  Gene(3204)  RefSeq(NM_006896)  OMIM(142950)  
Comments  
 
Homeodomain
HD1: RKRGRQTYTR YQTLELEKEF HFNRYLTRRR RIEIAHALCL TERQIKIWFQ NRRMKWKKEH
 
Noncoding Regulator(s)
hsa-mir-196 Function Sequence: UAGGUAGUUUCAUGUUGUUGGG
Location: chromosome 12q13.13; 17q21.32; 7p15.2
Target Position in 3'UTR of transcript ENST00000242159: 424/1193,
indicating as '#':

+-----------------------------#----------------------------------------------------+
target 5' U    GACCC    GAAA     UCUCACU        C 3'
           CCCA     GCAA    GUGAA       ACUACCUA    
           GGGU     UGUU    UACUU       UGAUGGAU    
miRNA  3'               G                         5'

mfe: -24.5 kcal/mol  p-value: 0.610649
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Yekta S, et al. 2004. Science [PubMed:15105502]
HGNC:31568
HGNC:31567
HGNC:31790
miRBase:MI0000279
miRBase:MI0000238
miRBase:MI0001150
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1