Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol HOXA9
Name homeobox A9
Class/Family ANTP/Hox9-13(15)
Type protein-coding
Organism Human
Location 7p15.2
Synonyms HOX1G
Link out HGNC(5109)  Gene(3205)  RefSeq(NM_152739)  OMIM(142956)  
Comments  
 
Homeodomain
HD1: TRKKRCPYTK HQTLELEKEF LFNMYLTRDR RYEVARLLNL TERQVKIWFQ NRRMKMKKIN
 
Noncoding Regulator(s)
hsa-mir-210 Function Sequence: CUGUGCGUGUGACAGCGGCUGA
Location: chromosome 11p15.5
Target Position in 3'UTR of transcript ENST00000242050: 875/1164,
indicating as '#':

+-------------------------------------------------------------#--------------------+
target 5' U    A    AUA           A 3'
           UCGG  GCU   CAUAUGUGCAG    
           AGUC  CGA   GUGUGCGUGUC    
miRNA  3'      GG   CA              5'

mfe: -25.7 kcal/mol  p-value: 0.604196
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Zhang Y. et al. 2011. J Cell Mol Med [PubMed:21388516]
HGNC:MIR210
miRBase:MI0000286
hsa-mir-196a Function Sequence: UAGGUAGUUUCAUGUUGUUGGG
Location: chromosome 12q13.13; 17q21.32
Target Position in 3'UTR of transcript ENST00000242050: 316/1164,
indicating as '#':

+----------------------#-----------------------------------------------------------+
target 5' U      UUAA    AAAGGAAA          U 3'
           CCUGAC    AACA        GAAACUACCU    
           GGGUUG    UUGU        CUUUGAUGGA    
miRNA  3'                A                 U 5'

mfe: -22.8 kcal/mol  p-value: 0.619187
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Dou LP, et al. 2011. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi [PubMed:21315047]
HGNC:31568
HGNC:31567
miRBase:MI0000279
miRBase:MI0000238
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1