Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol HOXD8
Name homeobox D8
Class/Family ANTP/Hox6-8
Type protein-coding
Organism Human
Location 2q31.1
Synonyms HOX4E
Link out HGNC(5139)  Gene(3234)  RefSeq(NM_019558)  OMIM(142985)  
Comments  
 
Homeodomain
HD1: RRRGRQTYSR FQTLELEKEF LFNPYLTRKR RIEVSHALAL TERQVKIWFQ NRRMKWKKEN
 
Noncoding Regulator(s)
hsa-mir-196 Function Sequence: UAGGUAGUUUCAUGUUGUUGGG
Location: chromosome 12q13.13; 17q21.32; 7p15.2
Target Position in 3'UTR of transcript ENST00000313173: 283/1083,
indicating as '#':

+---------------------#------------------------------------------------------------+
target 5' C                 U    A 3'
           CUCAACAACGU AAACU CCUA    
           GGGUUGUUGUA UUUGA GGAU    
miRNA  3'             C     U      5'

mfe: -27.1 kcal/mol  p-value: 0.595974
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Yekta S, et al. 2004. Science [PubMed:15105502]
HGNC:31568
HGNC:31567
HGNC:31790
miRBase:MI0000279
miRBase:MI0000238
miRBase:MI0001150
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1