Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol Barhl1
Name
Class/Family ANTP/Barhl
Type protein-coding
Organism Mouse
Location 2 A3; 2 17.0 cM
Synonyms MBH2; Dres115
Link out MGI(1859288)  Gene(54422)  RefSeq(NM_019446)   
Comments  
 
Homeodomain
HD1: KRKARTAFTD HQLAQLERSF ERQKYLSVQD RMELAASLNL TDTQVKTWYQ NRRTKWKRQT
 
Noncoding Regulator(s)
mmu-mir-203 Function Sequence: GUGAAAUGUUUAGGACCACUAG
Location: chromosome 12: 61.14cM
Target Position in 3'UTR of transcript ENSMUST00000021813: 404/512,
indicating as '#':

+----------------------------------------------------------------#-----------------+
target 5'  G   C    CU    GA   G 3'
            AGU GUCU  AGCA  UCA    
            UCA CAGG  UUGU  AGU    
miRNA  3' GA   C    AU    AA   G 5'

mfe: -18.2 kcal/mol  p-value: 0.634705
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Kim BM, et al. 2011. Development [PubMed:21307095]
MGI:2676878
miRBase:MI0000246
mmu-mir-7a Function Sequence: UGGAAGACUAGUGAUUUUGUUGU
Location: chromosome 13: 31.04cM; 7: 44.83cM
Target Position in 3'UTR of transcript ENSMUST00000021813: 197/512,
indicating as '#':

+-------------------------------#--------------------------------------------------+
target 5' C     UGGCC   GCUU          U 3'
           CAGCG     GAA    CUGGUCUUUC    
           GUUGU     UUU    GAUCAGAAGG    
miRNA  3' U             AGU           U 5'

mfe: -21.1 kcal/mol  p-value: 0.618935
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Kim BM, et al. 2011. Development [PubMed:21307095]
MGI:3619436
MGI:3619437
miRBase:MI0000728
miRBase:MI0000729
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1