Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol Pax7
Name
Class/Family PRD/Pax3/7
Type protein-coding
Organism Mouse
Location 4 E1; 4 69.0 cM
Synonyms Pax-7
Link out MGI(97491)  Gene(18509)  RefSeq(NM_011039)   
Comments  
 
Homeodomain
HD1: QRRSRTTFTA EQLEELEKAF ERTHYPDIYT REELAQRTKL TEARVQVWFS NRRARWRKQA
 
Noncoding Regulator(s)
mmu-mir-206 Function Sequence: UGGAAUGUAAGGAAGUGUGUGG
Location: chromosome 1
Target Position in 3'UTR of transcript ENSMUST00000030508: 1251/3725,
indicating as '#':

+---------------------------#------------------------------------------------------+
target 5'  A            AA   C    G 3'
            GCAC CUUUCUU  GCA UCCA    
            UGUG GAAGGAA  UGU AGGU    
miRNA  3' GG    U            A      5'

mfe: -24.8 kcal/mol  p-value: 0.622031
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Dey BK, et al. 2011. Mol Cell Biol [PubMed:21041476]
MGI:2676881
miRBase:MI0000249
mmu-mir-486 Function Sequence: UCCUGUACUGAGCUGCCCCGAG
Location: chromosome 8: 11.42cM
Target Position in 3'UTR of transcript ENSMUST00000030508: 1110/3725,
indicating as '#':

+------------------------#---------------------------------------------------------+
target 5'     U   U             G 3'
               GGC GCUCAGU CAGGA    
               CCG CGAGUCA GUCCU    
miRNA  3' GAGCC   U       U       5'

mfe: -31.4 kcal/mol  p-value: 0.591453
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Dey BK, et al. 2011. Mol Cell Biol [PubMed:21041476]
MGI:3619423
miRBase:MI0003493
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1