Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol Cux1
Name
Class/Family CUT/Cux
Type protein-coding
Organism Mouse
Location 5 G2; 5 78.0 cM
Synonyms CDP; Cux; Cutl1; Cux-1; Phox2; AA407197; KIAA4047; MGC102214; mKIAA4047
Link out MGI(88568)  Gene(13047)  RefSeq(NM_198602)  RefSeq(NM_009986)   
Comments  
 
Homeodomain
HD1: LKKPRVVLAP EEKEALKRAY QQKPYPSPKT IEELATQLNL KTSTVINWFH NYRSRIRREL
 
Noncoding Regulator(s)
mmu-mir-122 Function Sequence: UGGAGUGUGACAAUGGUGUUUG
Location: chromosome 18: 38.39cM
Target Position in 3'UTR of transcript ENSMUST00000065599: 320/776,
indicating as '#':

+---------------------------------#------------------------------------------------+
target 5'  U     A         U      G 3'
            GAUAC UAUUGUCAC AC CCA    
            UUGUG GUAACAGUG UG GGU    
miRNA  3' GU                  A     5'

mfe: -24.7 kcal/mol  p-value: 0.604053
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Xu H, et al 2010. Hepatology [PubMed:20842632]
MGI:2676805
miRBase:MI0000256
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1