Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol Dlx5
Name
Class/Family ANTP/Dlx
Type protein-coding
Organism Mouse
Location 6 A1; 6 2.0 cM
Synonyms AI385752
Link out MGI(101926)  Gene(13395)  RefSeq(NM_010056)  RefSeq(NM_198854)   
Comments  
 
Homeodomain
HD1: VRKPRTIYSS FQLAALQRRF QKTQYLALPE RAELAASLGL TQTQVKIWFQ NKRSKIKKIM
 
Noncoding Regulator(s)
mmu-mir-141 Function Sequence: UAACACUGUCUGGUAAAGAUGG
Location: chromosome 6: 59.17 cM
Target Position in 3'UTR of transcript ENSMUST00000052609: 13/354,
indicating as '#':

+---#------------------------------------------------------------------------------+
target 5'   C    GC    UUUUGGGACU         U 3'
             UCUU  UCAG          ACAGUGUUG    
             AGAA  GGUC          UGUCACAAU    
miRNA  3' GGU    AU                         5'

mfe: -21.1 kcal/mol  p-value: 0.613481
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Itoh T, et al. 2009. J Biol Chem [PubMed:19454767]
MGI:2676826
miRBase:MI0000166
mmu-mir-200a Function Sequence: UAACACUGUCUGGUAACGAUGU
Location: chromosome 4: 87.96 cM
Target Position in 3'UTR of transcript ENSMUST00000052609: 25/354,
indicating as '#':

+------#---------------------------------------------------------------------------+
target 5'   U   GG              U 3'
             UUG  ACU  ACAGUGUUG    
             AGC  UGG  UGUCACAAU    
miRNA  3' UGU   AA   UC           5'

mfe: -21.5 kcal/mol  p-value: 0.611138
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Itoh T, et al. 2009. J Biol Chem [PubMed:19454767]
MGI:2676874
miRBase:MI0000554
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1