Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol HOXD4
Name homeobox D4
Class/Family ANTP/Hox4
Type protein-coding
Organism Human
Location 2q31.1
Synonyms HOX4B
Link out HGNC(5138)  Gene(3233)  RefSeq(NM_014621)  OMIM(142981)  
Comments  
 
Homeodomain
HD1: PKRSRTAYTR QQVLELEKEF HFNRYLTRRR RIEIAHTLCL SERQIKIWFQ NRRMKWKKDH
 
Noncoding Regulator(s)
hsa-mir-10a Function Sequence: UACCCUGUAGAUCCGAAUUUGUG
Location: chromosome 17q21.32
Target Position in 3'UTR of transcript ENST00000306324: 38/284,
indicating as '#':

+-----------#----------------------------------------------------------------------+
target 5' G  U  GC  AAG        G  3'
           GC GA  CG   CUGCGGGG     
           UG UU  GC   GAUGUCCC     
miRNA  3' G  U  AA  CUA        AU 5'

mfe: -21.7 kcal/mol  p-value: 0.607424
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Tan Y. et al. 2009. BMC Mol Biol [PubMed:19232136]
HGNC:31497
miRBase:MI0000266
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1