Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol HOXA5
Name homeobox A5
Class/Family ANTP/Hox5
Type protein-coding
Organism Human
Location 7p15.2
Synonyms HOX1C
Link out HGNC(5106)  Gene(3202)  RefSeq(NM_019102)  OMIM(142952)  
Comments  
 
Homeodomain
HD1: GKRARTAYTR YQTLELEKEF HFNRYLTRRR RIEIAHALCL SERQIKIWFQ NRRMKWKKDN
 
Noncoding Regulator(s)
hsa-mir-130a Function Sequence: CAGUGCAAUGUUAAAAGGGCAU
Location: chromosome 11q12.1
Target Position in 3'UTR of transcript ENST00000222726: 565/783,
indicating as '#':

+----------------------------------------------------------#-----------------------+
target 5' C        AUAG   CCU      G  3'
           GUGCCUUU    GAC   UUGCAC     
           UACGGGAA    UUG   AACGUG     
miRNA  3'          AA     U        AC 5'

mfe: -25.0 kcal/mol  p-value: 0.602564
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Chen Y. et al. 2008. Blood [PubMed:17957028]
HGNC:31514
miRBase:MI0000448
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1