Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol HOXB5
Name homeobox B5
Class/Family ANTP/Hox5
Type protein-coding
Organism Human
Location 17q21.32
Synonyms HOX2A
Link out HGNC(5116)  Gene(3215)  RefSeq(NM_002147)  OMIM(142960)  
Comments  
 
Homeodomain
HD1: GKRARTAYTR YQTLELEKEF HFNRYLTRRR RIEIAHALCL SERQIKIWFQ NRRMKWKKDN
 
Noncoding Regulator(s)
hsa-miR-221 Function Sequence: AGCUACAUUGUCUGCUGGGUUUC
Location: chromosome Xp11.3
Target Position in 3'UTR of transcript ENST00000239151: 11/952,
indicating as '#':

+-#--------------------------------------------------------------------------------+
target 5' A            CC   G     C 3'
           GGAGCCCAGCGG  CAA   AGC    
           CUUUGGGUCGUC  GUU   UCG    
miRNA  3'              U    ACA   A 5'

mfe: -29.6 kcal/mol  p-value: 0.581729
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Kim HJ. et al. 2008. J Nucl Med [PubMed:18794255]
HGNC:31601
miRBase:MI0000298
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1