Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol Hoxa9
Name
Class/Family ANTP/Hox9-13(15)
Type protein-coding
Organism Mouse
Location 6 B3; 6 26.32 cM
Synonyms D6a9; Hox-1.7
Link out MGI(96180)  Gene(15405)  RefSeq(NM_010456)   
Comments  
 
Homeodomain
HD1: TRKKRCPYTK HQTLELEKEF LFNMYLTRDR RYEVARLLNL TERQVKIWFQ NRRMKMKKIN
 
Noncoding Regulator(s)
mmu-mir-126 Function Sequence: UCGUACCGUGAGUAAUAAUGCG
Location: chromosome 2:18.96 cM
Target Position in 3'UTR of transcript ENSMUST00000114425: 189/448,
indicating as '#':

+----------------------------------#-----------------------------------------------+
target 5'  A   G    C     ACGGGACCGCA       G 3'
            CAU   UA CUCAC           GGUACGA    
            GUA   AU GAGUG           CCAUGCU    
miRNA  3' GC   AUA                            5'

mfe: -20.7 kcal/mol  p-value: 0.618931
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Shen WF. et al. 2008. Mol Cell Biol [PubMed:18474618]
MGI:2676811
miRBase:MI0000153
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1