Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol Hoxa11
Name
Class/Family ANTP/Hox9-13(15)
Type protein-coding
Organism Mouse
Location 6 B3; 6 26.33 cM
Synonyms Hox-1.9; Hoxa-11
Link out MGI(96172)  Gene(15396)  RefSeq(NM_010450)   
Comments  
 
Homeodomain
HD1: TRKKRCPYTK YQIRELEREF FFSVYINKEK RLQLSRMLNL TDRQVKIWFQ NRRMKEKKIN
 
Noncoding Regulator(s)
mmu-mir-181a Function Sequence: AACAUUCAACGCUGUCGGUGAGU
Location: chromosome 1: 60.68cM; 2: 24.42cM
Target Position in 3'UTR of transcript ENSMUST00000048026: 1170/1252,
indicating as '#':

+---------------------------------------------------------------------------#------+
target 5' A       C  U  UAAAAUAU        A 3'
           ACUCGCU AC GC        UUGAAUGU    
           UGAGUGG UG CG        AACUUACA    
miRNA  3'         C  U  C               A 5'

mfe: -24.7 kcal/mol  p-value: 0.610820
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Naguibneva I. et al. 2006. Nat Cell Biol [PubMed:16489342]
MGI:3629589
MGI:2676845
miRBase:MI0000697
miRBase:MI0000223
mmu-mir-181b Function Sequence: AACAUUCAUUGCUGUCGGUGGGU
Location: chromosome 1:60.68 cM; 2:24.42 cM
Target Position in 3'UTR of transcript ENSMUST00000048026: 1170/1252,
indicating as '#':

+---------------------------------------------------------------------------#------+
target 5' A       C  U  UAAAAUAUU       A 3'
           ACUCGCU AC GC         UGAAUGU    
           UGGGUGG UG CG         ACUUACA    
miRNA  3'         C  U  UU              A 5'

mfe: -24.1 kcal/mol  p-value: 0.613886
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Naguibneva I. et al. 2006. Nat Cell Biol [PubMed:16489342]
MGI:3618735
MGI:3618736
miRBase:MI0000723
miRBase:MI0000823
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1